Purification of DNA and Plasmid

06/11/09 -

Attended Lab meeting where I was able to update Dylan with the progress my project is making.

Cells were passaged:
P.34 and P.35 were given medium

10/11/09 -

7 flasks of my P.29 cells became infected and were thrown away.

13/11/09 -

Whilst carrying out her own experiments Tracey tested the expression of Zmpste24 in SW1353 cells and found it was highly expressed. Therefore we decided to extract and purify the Zmpste24 from these cells using the following method:

- Add 150 microL to 50 microL of the PCR product
- Add 200 microL of phenol cholorform
- Vortex for 5 seconds
- Centrifuge at 13,000 rpm for 10 minutes at 4 degrees Celsius
- Put the upper phase into a new eppendorf
- Add 500 microL 100% ethanol
- Add 20 microL sodium acetate
- Add 1 microL glycogen (this will act as a branching molecule which will grab the smaller fragments of DNA and bring them down into the pellet)
- Centrifuge at 13,000 rpm for 10 minutes at 4 degrees celcius
- Remove supernatant
- Add 500 microL 70% ethanol (do not resuspend)
- Spin as before
- Remove supernatant
- Leave to air dry (will take about 10 minutes if all dregs are removed)
- Resuspend in 100 microL water (as there was a big pellet)

The DNA was then stored at -20 degrees Celsius.

I met with Dylan to discuss my project and the next steps we will be taking. The first issue that needed to be addressed was whether to keep all my flasks of cells as I have too many. It was decided to keep P.35 and P.34 to extract the RNA at a later date, then keep at most two flasks of P.29 to keep passaging, harvesting RNA and Protein each time, keeping the flasks of cells to a maxium of 2. The rest could be thrown away. The cells will need to be split at a certain density so that we know how many population doublings have occurred in each passage, I will work with Alba to do this.

Over the next week or so I will also be working with Caroline Pennington to quantify the amount of Zmpste24 in the RNA I have already harvested and will also be looking at the amount of mir-34 and Zmpste24 in a number of cancer cell lines.

16/11/09 -

The purifyied Zmpste24 DNA was digested with the restriction enzyme HindIII to create sticky ends using the following method: -

Into an eppendorf tube add:-
- 80 microL PCR product (purified DNA from previous step)
- 10 microL HindIII buffer
- 10 microL HindIII enzyme

Incubate at 37 degrees Celsius for 3 hours.

I then harvested RNA from P.28 and P.29 cells using the same method as previously.

RNA concentration:

P.28 = 465 ng/microL (260/280 = 1.95, 260/230 = 1.26)
P.29 = 475 ng/microL (260/280 = 1.92, 260/230 = 1.28)

17/11/09 -

The digested DNA was then purified again using the phenol cholorform method.

100 microL of water was added to 100 microL of the product then the method was followed exactly as before.
The pellet was resuspended in 50 microL water.

The purified product was then run on a 1.5% agarose gel (made as before) to check if anything had been recovered. But as the gel was setting it had leaked making the gel very thin. After looking under UV light it no band could be seen.

The product was run again along with a 1kb + ladder and pmir report which will be used as the vector. This time a clear band could be seen.

19/11/09 -

All of my cells, except for two flask of P.29, became infected and had to be thrown away. It is thought to be because the medium contained no antibiotics.

Pen Strep antibiotics were added to my medium, then one flask of P.29 cells was passaged to two P.30 flasks. The cells from the other flask were harvested to extract protein as follows:

- Wash cells with 1 x PBS
- Add 1 ml PBS
- Scrape
- Transfer to an eppendorf tube
- Spin at 13,000 rpm for 5 minutes at 4 degrees Celsius
- Remove PBS
- Place pellet on ice
- Resuspend in RIPA buffer (use 3 x the volume of the pellet, in this case we used 100 microL)
(Ensure RIPA buffer has had a protease inhibitor tablet dissolved into it first)
- Leave on ice for 20 minutes
- Centrifuge at 10,000 rpm for 10 minutes at 4 degress Celsius
- Transfer supernatant to a new eppendorf
- Store at -20 degrees Celsius

An agarose gel containing the linearised plasmid was viewed under UV light to allow visualisation of the plasmid, which was then cut out of the gel and put into an eppendorf tube. The plasmid was then extracted using a QIAGEN extraction kit.

20/11/09 -

The DNA concentration of the Zmpste24 PCR product and the pmir report was measured using the nanodrop:

DNA concentration:
Pmir Reporter (which has been cut with HindIII) = 7.6 ng/micro L
Zmpste24 PCR product = 35.6 ng/microL

Four ligations were then set up to run over night.

The amount of insert was kept constant and a final volume of 20 microL was made up using water. The ligations were set up as follows:

1) 1 microL vector + 1 microL insert + 2 microL ligase + 2 microL buffer + 14 microL water
2) 5 microL vector + 1 microL insert + 2 microL ligase + 2 microL buffer + 10 microL water
3) 1 microL vector + 2 microL ligase + 2 microL buffer + 15 microL water
4) 5 microL vector + 2 microL ligase + 2 microL buffer + 11 microL water

Ligations 3 and 4 will act as controls.

The ligations were incubated at 16 degrees Celsius over night in the PCR machine.

Continuing RT and PCR

30/10/09 -

Made an agarose gel consisting of 1.5% (0.75g) agarose with 50ml TBE buffer.

The samples were loaded into the gel with a 1kb ladder. It was run for 1 hour and then the gel was stained with ethidium bromide and was photographed using UV light. Unfortunately the PCR did not work as no DNA was present and only the primers appeared on the gel.

02/11/09 -

RNA was harvested from P.28 cells. This time the TRIzol was put directly into the flask of cells in the hope that this would lyse the cells more efficiently and ensure every cell is collected. This was done in the following way:

- Pour off medium
- Add PBS to wash
- Pour off PBS
**In fume hood**
- Add 1ml TRIzol
- Scrape cells into corner
- Add 500microL to two eppendorfs
- Add 250microL chloroform
-Vortex
Continue extraction process as described previously.

Using the nanodrop the RNA concentration was measured:

RNA concentration - 785.4ng/microL
260/280 - 1.87
260/230 - 0.78

260/280 and 260/230 are both measures of purity. The ideal value for 260/280 should be close to 2 and for 260/230 should be close to 1.

The RNA was then stored at -80 degrees Celsius.

03/11/09 -

cDNA was made from the RNA extracted from the P.28 cells using the same method as previously.

The cDNA was then stored in the freezer.

04/11/09 -

Another PCR reaction was set up in the same manner as before this time with three tubes containing 2 microL cDNA and one tube containing 4 microL cDNA. The final volume was made up to 50 microL using water.

The three tubes were again went through the PCR at three temperatures 50, 55 and 60 degrees Celsius. The tube with 4 microL cDNA was put through the PCR at 55 degrees.

Again I took photos of each flask of cells. Hopefully over time the ageing of the cells will be apparent through these photographs.

05/11/09 -

A 1.5% agarose gel was made and the samples were run for an hour along with a 1kb ladder. The gel was stained with ethidium bromide and photographed under UV light.

Again the PCR did not work, only the primers an primers which had dimerised showed up on the photograph.

This may be because the MRC-5 cells have a low expression of Zmpste24 or that the binding site is right at the end of the 3' UTR and the primers are not binding very well. The next step is to look at the expression of Zmpste24 in these cells as well as a number of other cell lines.

06/11/09 -

Passaged 11 P.28 to 22 P.29 and 2 P.27 to 4 P.28
New medium was added to P.34 and P.35

Harvesting RNA and beginning Reverse Transcriptase and PCR

23/10/09 -

One of the P.26 passage became infected so contents were washed with Trigene to disinfect it and kill everything within, then the contents was disposed of.

After checking cells it was seen that one of the P.34 passages is now senescent. These cells can be seen as they differ from the normal fibroblast cells which are long and thin, where as the senescent cells are flatter, rounder and more relaxed. They are quite noticably different from the dividing cells. The cells were given new medium. P.35 and one P.26 flask were given new medium where as the other 3 of the P.26 flask were passaged to P.27.

Each time the cells are passaged it is a population doubling and the cells are ageing. I will keep passaging the cells to age them and encourage them into senescence while at the same time periodically harvesting RNA.

RNA was harvested from one P.26 passage and one P.35 passage. The same method was done for each passage. This was done as follows: -

- Pour medium away, leaving a little bit in the flask. - using a scraper scrap cells into the corner (you can see the cells moving as they begin to clump together)

- Once you are confident all cells have been scraped off the surface use pipette remaining medium into an eppendorf tube

- Spin tubes to form a pellet

- Remove supernatant

- Resuspend pellet in 1ml of PBS buffer

- Take 2 eppendorf tubes and add 500microL of the buffer mixture

-Centifuge

**Must remember to use green gloves when using TRIzol as it is phenol based**

Then inside a fume hood: -

-Resuspend one of the pellets in 500microL TRIzol and pipette into the other tube, resuspending that pellet

Cells were then frozen and the RNA will be extraced on Monday.

The miR-34a and the miR-34c-5p binding sites within the Zmpste24 binding site have been identified using microRNA.org. It was shown that the binding site is right at the end of the 3'UTR beginning at position 1481. Using the 3'UTR sequence, the binding site has been identified as:

TGAAACATTAAACATTGCCA

Tracey and I discussed the vector we will be using in the cloning. Tracey has previously had success using the Pmir report vector :

We will use only one restriction enzyme (HindIII) to cut the vector. This will allow the gene to be inserted in either orientation, which acts as a control.

The hindIII restriction enzyme recognises and cuts at the following sequence:

This sequence will then have a primer sequence that we will design attached in the 5'-3' direction. At the 5' end we will also attach a short extra sequence, for example GACA, which provide an area for the restriction enzyme to bind. The same process will be done for the other strand aswell.

27/10/09-

The RNA extraction was continued as follows: -

**In fume hood**

- Add 200microL choloform

- Vortex (to mix contents)

- Centrifuge at 13000 rpm for 10 minutes in cold room ( 4 degrees Celsius)

This process will give three phases, the top phase will be RNA, the middle protein and other organic material and the bottom DNA

- Remove top layer, very carefully, and pipette into new eppendorf tube

- Add 500microL isopropenol (which precipitates the RNA into a pellet)

- Leave at room temperature for 5 minutes

- Centrifuge at 13000 rpm for 10 minutes in cold room

-Remove supernatant

- Wash with 70% ethanol, do not resuspend the pellet

- Centrifuge for 10 minutes at 13000 rpm in cold room

- Remove ethanol, use smaller pipette to get rid of dregs

- Leave to air dry

- Resuspend pellet in 20microL in water

The RNA concentration was then measured using the nanodrop. The nanodrop is first blanked with water to callibrate it. Then one microL of each sample is measured.

For a useable sample the minimum amount of RNA wanted is 100ng/microL

Results: -

P.26 = 0.7ng/microL

P.35 = 76ng.microL

P.26 RNA concentration was much to low to use, where as P.35 was just acceptable. The reverse transcription gives 836ng in 11 microL of solution, so it was decided to use this RNA in the PCR reaction.

I also took photos of each flask of cells. This will allow us to record any changes in the appearance of the cells.

29/10/09

First I needed to created the complimentary DNA sequence (cDNA), this was done by using reverse transcriptases, a process which assumes 100% efficieny and so gives 1 microgram of cDNA.

**On ice**

- Add 10 microL RNA to 1 microL oligo dT primers

(These primers put tags which attach to the polyA tails on the ends of the RNA, during the reverse transcriptase process these primers will elongate and prime only the messages, as these are the only RNA which have polyA tails.)

- Incubate at 70 degrees Celsius for 10 minutes

- On ice add:

4 microL 5 X first strand synthesis buffer

2 microL DTT

1 microL dNTPs

2 microL RNase Inhibitor (there is RNase everywhere, on fingers etc. so we need the inhibitor to prevent the RNA being degraded)

- Incubate for 2 minutes at 42 degrees Celsius

- Add 1 microL superscript

- Incubate for one hour at 42 degrees Celsius, then at 70 degrees Celsius for 10 minutes.

New medium was added to P.34 and P.35. The P.35 flask is showing signs of senescence aswell. I will monitor these cells and take pictures to note any differences.

P.26 was passaged to P.27

6 flasks of P.27 were passaged to 12 flasks of P.28

Now we have cDNA a PCR can be carried out to amplify the DNA. This was done as follows:

- In a PCR tube add:

2 microL cDNA

5 microL acutaq buffer

1 microL dNTP

1 microL of each primer (forward and reverse)

1 microL acutaq (a DNA polymerase which decreases the rate of mutation)

The 3 PCRs were carried out over night at 3 different temperatures 50 degrees Celsius, 55 degrees Celsius and 60 degrees Celsius.