Harvesting RNA and beginning Reverse Transcriptase and PCR

23/10/09 -

One of the P.26 passage became infected so contents were washed with Trigene to disinfect it and kill everything within, then the contents was disposed of.

After checking cells it was seen that one of the P.34 passages is now senescent. These cells can be seen as they differ from the normal fibroblast cells which are long and thin, where as the senescent cells are flatter, rounder and more relaxed. They are quite noticably different from the dividing cells. The cells were given new medium. P.35 and one P.26 flask were given new medium where as the other 3 of the P.26 flask were passaged to P.27.

Each time the cells are passaged it is a population doubling and the cells are ageing. I will keep passaging the cells to age them and encourage them into senescence while at the same time periodically harvesting RNA.

RNA was harvested from one P.26 passage and one P.35 passage. The same method was done for each passage. This was done as follows: -

- Pour medium away, leaving a little bit in the flask. - using a scraper scrap cells into the corner (you can see the cells moving as they begin to clump together)

- Once you are confident all cells have been scraped off the surface use pipette remaining medium into an eppendorf tube

- Spin tubes to form a pellet

- Remove supernatant

- Resuspend pellet in 1ml of PBS buffer

- Take 2 eppendorf tubes and add 500microL of the buffer mixture

-Centifuge

**Must remember to use green gloves when using TRIzol as it is phenol based**

Then inside a fume hood: -

-Resuspend one of the pellets in 500microL TRIzol and pipette into the other tube, resuspending that pellet

Cells were then frozen and the RNA will be extraced on Monday.

The miR-34a and the miR-34c-5p binding sites within the Zmpste24 binding site have been identified using microRNA.org. It was shown that the binding site is right at the end of the 3'UTR beginning at position 1481. Using the 3'UTR sequence, the binding site has been identified as:

TGAAACATTAAACATTGCCA

Tracey and I discussed the vector we will be using in the cloning. Tracey has previously had success using the Pmir report vector :

We will use only one restriction enzyme (HindIII) to cut the vector. This will allow the gene to be inserted in either orientation, which acts as a control.

The hindIII restriction enzyme recognises and cuts at the following sequence:

This sequence will then have a primer sequence that we will design attached in the 5'-3' direction. At the 5' end we will also attach a short extra sequence, for example GACA, which provide an area for the restriction enzyme to bind. The same process will be done for the other strand aswell.

27/10/09-

The RNA extraction was continued as follows: -

**In fume hood**

- Add 200microL choloform

- Vortex (to mix contents)

- Centrifuge at 13000 rpm for 10 minutes in cold room ( 4 degrees Celsius)

This process will give three phases, the top phase will be RNA, the middle protein and other organic material and the bottom DNA

- Remove top layer, very carefully, and pipette into new eppendorf tube

- Add 500microL isopropenol (which precipitates the RNA into a pellet)

- Leave at room temperature for 5 minutes

- Centrifuge at 13000 rpm for 10 minutes in cold room

-Remove supernatant

- Wash with 70% ethanol, do not resuspend the pellet

- Centrifuge for 10 minutes at 13000 rpm in cold room

- Remove ethanol, use smaller pipette to get rid of dregs

- Leave to air dry

- Resuspend pellet in 20microL in water

The RNA concentration was then measured using the nanodrop. The nanodrop is first blanked with water to callibrate it. Then one microL of each sample is measured.

For a useable sample the minimum amount of RNA wanted is 100ng/microL

Results: -

P.26 = 0.7ng/microL

P.35 = 76ng.microL

P.26 RNA concentration was much to low to use, where as P.35 was just acceptable. The reverse transcription gives 836ng in 11 microL of solution, so it was decided to use this RNA in the PCR reaction.

I also took photos of each flask of cells. This will allow us to record any changes in the appearance of the cells.

29/10/09

First I needed to created the complimentary DNA sequence (cDNA), this was done by using reverse transcriptases, a process which assumes 100% efficieny and so gives 1 microgram of cDNA.

**On ice**

- Add 10 microL RNA to 1 microL oligo dT primers

(These primers put tags which attach to the polyA tails on the ends of the RNA, during the reverse transcriptase process these primers will elongate and prime only the messages, as these are the only RNA which have polyA tails.)

- Incubate at 70 degrees Celsius for 10 minutes

- On ice add:

4 microL 5 X first strand synthesis buffer

2 microL DTT

1 microL dNTPs

2 microL RNase Inhibitor (there is RNase everywhere, on fingers etc. so we need the inhibitor to prevent the RNA being degraded)

- Incubate for 2 minutes at 42 degrees Celsius

- Add 1 microL superscript

- Incubate for one hour at 42 degrees Celsius, then at 70 degrees Celsius for 10 minutes.

New medium was added to P.34 and P.35. The P.35 flask is showing signs of senescence aswell. I will monitor these cells and take pictures to note any differences.

P.26 was passaged to P.27

6 flasks of P.27 were passaged to 12 flasks of P.28

Now we have cDNA a PCR can be carried out to amplify the DNA. This was done as follows:

- In a PCR tube add:

2 microL cDNA

5 microL acutaq buffer

1 microL dNTP

1 microL of each primer (forward and reverse)

1 microL acutaq (a DNA polymerase which decreases the rate of mutation)

The 3 PCRs were carried out over night at 3 different temperatures 50 degrees Celsius, 55 degrees Celsius and 60 degrees Celsius.