Tuesday, 2 February 2010

Taqman Results and Transfection

20/01/2010 -

The Taqman results gave a circumstantial relationship between miR-34 and Zmpste24, as it was seen in cells high in miR-34 there was a low level of Zmpste24 and vice versa, indicating that Zmpste24 was a likely target for miR-34.

10 more cultures were mini-prepped and digested using the Sac1 restriction enzyme. The gel image again revealed the insert had been incorporated in the wrong way. But every vector had the insert, which is unusual due to the low efficiency rate of the transformation so it is thought that the undigested vector is predominant on the plate.

A transfection was set up using the SW1353 cells which had been plated and were allowed to grow until they were confluent. The cells were tested with a control (scrambled) which scrambles the miR-34 binding site and a miR-34 mimic at 3 different concentrations, 10nM, 20nM, and 50nM.

The following volumes were added to 200 microL serum free medium in separate eppendorfs

Control:

10nM - 0.4 microL
20nM - 0.8 microL
50nM - 2 microL

miR-34 mimic

10nM - 1 microL
20nM - 2 microL
50nM - 5 microL

The eppendorfs were then incubated at room temperature for 5 minutes.

During this incubation period a 15x mastermix of lipofectamine 2000 (a transfection agent which, when combined with the mimic, will transport the mimic into the cell) and serum free medium was made.

1X = 4 microL lipofectamine, 196 microL serum free medium
15X = 60 microL lipofectamine, 2.9mls serum free medium

Once the incubation period was over 200 microL of the mastermix was added to each eppendorf. These were then incubated at room temperature for 20 minutes.

After this incubation period was finished the solutions were added to each well in a drop-wise fashion. The plate was then incubated at 37 degrees Celsius for 48 hours. How the 6 well plate was organised is shown below.



21/01/2010 -

A PCR purification was done using a QIAgen QIAquick PCR purification as per the protocol provided with the following changes:

100microL PB1 added to sample
50microL water used to elute DNA rather than EB

The DNA was then digested using 10microL H3 enzyme, 10microL H3 buffer, 30microL water (this brings the final volume to 100microL). The sample was then digested for 3 hours at 37 degrees Celsius.

5 microL of the sample was run on a 1.5% agarose gel to test the digestion. The digestion worked very well and the insert and vector were cleanly cut. Again the insert was 400bp, but this time no background vector appeared on the gel image.

25/01/2010

A western blot was set up using the transfected cells. The total protein concentration was measured and the following volumes were loaded (+4 microL loading buffer) to ensure the same amount of protein was loaded in each lane (80nM)

Transfection Absorbance Protein Conc. (ng/microL) Volume loaded (microL)
Scrambled10 0.48 4.8 16.6
Scrambled 20 0.65 6.4 12.5
Scrambled 50 0.57 5.7 14
miR-34 10 0.63 6.3 12.7
miR-34 20 0.51 5.1 9.8
miR-34 50 0.52 5.2 5.1

The protein and loading buffer were boiled for 5 minutes at 90 degrees Celsius on a hot block before loading. The gel was then run at 150V for 1 hour.

Once the gel has finished running it was transferred to a membrane using the same method as previously described.

While the proteins were being transferred to the membrane 12 more colonies were picked and incubated in LB + 5 microL ampicillin and incubated overnight, shaking, at 37 degrees Celsius.

26/01/2010

The 'quick and dirty' mini-prep method was used to purify the plasmid DNA.

The primary Zmpste24 antibody was applied to the membrane yesterday and it was left in the cold room overnight.

The secondary antibody was then applied and the membrane put on the shaking platform for 1 hour.

After this hour it was washed in PBS tween, 2 x 5 mins on the shaking platform. Then 1ml of a chemiluminescent was added and left to incubate for 1 minute. The membrane was then transferred to an AUTO-RAD sheet and left to develop for 1, 5 and 10 minutes.
The developed AUTO-RAD sheets can be seen in my lab diary.

The plasmid DNA was digested with Sac1 as previously and the samples run on an electrophoresis gel. Only one vector had incorporated the insert, but again in the wrong orientation.

28/1/2010

A flask of P.34 cells were harvested and protein and RNA was extracted using the same method as previously described. New medium was added to the second flask to keep the cells alive until we can photograph them. These cells are now reaching the stage of senescence.

Sunday, 24 January 2010

Taqman MicroRNA Assay

19/01/2010 -

A Taqman microRNA assay was set up using the cDNA created yesterday. I started with 4 different types of cDNA :

1 - HeLa + random hexamers
2 - HeLa + miR-34 primers
3 - SW1353 + random hexamers
4 - SW1353 + miR-34 primers

Each of these cDNAs were then diluted 1 in 100 (2 µl cDNA in 198 µl water)

Then using the undiluted cDNA a number of dilutions were set up:
For random hexamers (use either HeLa or SW1353 cDNA)
1/10 - 2 µl undiluted cDNA + 18 µl water
1/100 - 2 µl cDNA + 198 µl water
1/1000 - 54 µl water + 6 µl 1/100 dilution
1/10000 - 54 µl water + 6 µl 1/1000 dilution.

Vortex briefly after each dilution.

For miR-34 (use either SW1353 or HeLa cDNA)
1/10 - 2 µl cDNA + 18 µl water
1/100 - 2 µl cDNA in 198 µl water

These dilutions were then used to create 18S, Zmpste24 and miR-34 standard curves as follows:

18S standard curve:
6 eppendorfs were set up as follows



Sample gene -
This method is the same for both Zmpste24 and miR-34 standard curves. For Zmpste24 use random hexamer dilutions and for miR-34 use the miR-34 primer dilutions



Once each of the standard curves have been prepared the Taqman plate was then loaded as follows: -

A1 = 2µl HeLa RH + 8µl water
A2 = 2µl SW1353 RH + 8µl water
B1 = 10µl HeLa RH
B2 = 10µl SW1353 RH
C1 = 10µl HeLa miR-34 primers
C2 = 10µl SW1353 miR-34 primers
A3-A8 = 10µl 18S standard curve
B3-B8 = 10µl Zmpste24 standard curve
C3-C8 = 10µl miR-34 standard curve
A12, B12, C12 = 10µl water (which acts as a negative control)

10x mastermix was made up as follows:


15µl of the appropriate mix was added to the appropriate well:
A1-A8, A12 = 15µl 18S
B1-B8, B12 = 15µl Zmpste24
C1-C8, C12 = 15µl miR-34

The plate was then run in the Taqman machine.

Transformations, Digestions and Reverse Transcriptions.

12/01/2010 -

Using the ligations Tracey created over the Christmas holidays further transformations were set up using the DHS-Alpha bacteria, following the same protocol as previously. The agar plates were then incubated overnight at 37 degrees Celsius.

13/01/2010 -

Lots of colonies grew on the 1 µl and 3 µl plates but not as many on the 5 µl plate. It was decided to pick colonies from the 1 µl and 3 µl plates but not the 5 µl plates as these colonies did not work as well when Tracey did the transformation, but they will be left as a back up. 5 colonies were picked from each plate. These were then incubated in LB + 5 µl ampicillin overnight at 37 degrees Celsius, shaking overnight.

14/01/2010 -

DNA purification using a quick method which does not use columns.
This method is used when there are a lot of samples (10 in my case) as the QIAgen mini-prep method is expensice, by not using columns it makes it cheaper. The protocol is as follows:
1) Take 1.5ml culture and spin at 13,000rpm for 2 minutes to form a pellet.
2) Remove supernatant
3) Add 100 µl of P1 resuspension buffer
4) Resuspend pellet very gently.
5) Add 200 µl of P2 buffer
6) Add 150 µl of P3 buffer
7) Invert 6 times
8) Centrifuge at 13,000rpm for 3 minutes
9) Add supernatant to 1ml of 100% ethanol (in clean eppendorf tubes)
10) Vortex
11) Centrifuge at 13,000 rpm for 10 minutes
12) Remove ethanol, use a smaller pipette to remove dregs
13) Leave to air dry
14) Resuspend pellet in 40 µl water

Then two digests were set up using H3 and Sac1 restriction enzymes.

1 µl DNA
1 µl enzyme buffer
1 µl enzyme
7 µl water

These digestions were incubated at 37 degrees Celsius for 1 hour. Once the digestion was completed the samples were run on an agarose electrophoresis gel. The image revealed none of the vectors had taken up the insert.

15/01/2010 - 17/01/2010 -

Over the weekend Tracey set up a number of mini-preps using the colonies I had grown previously. These were purified using the no columns method then digested using Sac1. After running on an electrophoresis gel it was revealed no insert had been taken up.

Tracey then re-ligated the vectors which had contained the insert in the wrong orientation. The DNA was purified and digested with Sac1. Again it was seen that insert has been incorporated, but in the wrong orientation. This may have been because not all the initial vector had been re-ligated and this was what was coming through on the gel.

18/01/2010 -

Reverse Transcription - creation of cDNA for use in a Taqman MicroRNA assay.

Tracey had previously extracted RNA from SW1353 and HeLa cells, both of which are Cancer cell lines (SW1353= Human Bone Chondrosarcoma, HeLa= Cervical Carcinoma)

This RNA was very concentrated so was diluted 1 in 5 (5 µl RNA in 25 µl water). The nanodrop was then used to check the diluted concetration:

SW1353 = 711.8 ng/ µl
HeLa = 6.18 ng/ µl

This was still very concentrated so the RNA was diluted again

SW1353 = 1.4 µl in 7.6 µl water
HeLa = 1.6 µl in 7.4 µl water

This gave a final volume of 9 µl

For each cell line 2 tubes were set up one which will use random hexamers and one which would use miR-34 primers.

To the diluted RNA 2 µl of either random hexamers or miR-34 primers was added. The tubes were then incubated at 70 degrees Celsius for 10 minutes, using a hot block.

While the tubes were incubating a 5x mastermix of reverse transcription agents was made up. By making this mastermix it helps with precision of pipetting and helps to keep the volume of each agent pipetted in each tube constant, helping with accuracy.

On ice add : -

1x 5x
4 µl 5 x 1st strand buffer 20 µl
2 µl DTT 10 µl
1 µl dNTPs 5 µl
1 µl Superscript RT 5 µl
1 µl RNase Inhibitor 5 µl

9 µl of the mastermix was added to each tube
These tubes were then incubated at 42 degrees Celsius for 1 hour then at 70 degrees Celsius for 10 minutes
The tubes were then stored at -20 degrees Celsius.

Tracey picked 12 colonies and incubated then in LB + 5 µl ampicillin overnight at 37 degrees Celsius, shaking, overnight.

Christmas Holidays

Over the Christmas holidays Tracey set up a number of ligations with ratios of 1 µl, 3 µl and 5 µl insert to 1 µl of vector. From these ligations transformations were done which were consequently plated onto agar. Once these colonies had grown 10 were picked and Ph-Chl cleaned and digested with H3 (the restriction enzyme HindIII). These samples were then run on an agarose electrophoresis gel to check if the insert had been incorporated into the vector. The gel image revealed of the 10 colonies only 1 had taken up the vector.

Next it needed to be checked whether the insert had been incorporated into the vector in the correct orientation. This is done by digesting with the restriction enzyme Sac1. The vector and insert both contain Sac1 restriction sites, the site with in the insert is off centre allowing for two different sized fragments depending on the orientation of the insert. After digestion with Sac1 if the insert is in the correct orientation the fragment is 100bp, if it is the wrong way round the fragment will be 400bp.

Once the digestion of Sac1 was complete the fragments were run on an electrophoresis gel. The gel image revealed the insert was 400bp and therefore the insert was in the incorrect orientation.

These vectors will still be used as positive controls as they contain the anti-sense strand for the miR-34 binding site. The fact that any insert was incorporated was also a good thing as it illustrated that the transformation has actually been working. It also indicates a very low efficiency for the experiment.

Saturday, 19 December 2009

Taqman results, Plasmid DNA purification and re-transformation

2/12/2009 -

The Taqman assay showed each of the cell lines expressed Zmpste24 at differing levels. The assay worked well which is encouraging as we were unsure that the RNA was of a good quality.

The results were analysed using Excel. All cycles in 18S should be amplifying within 1.5 cts (cycle thresholds) of each other, any that were not were removed from the analysis. These cell lines were unlikely to have RNA that was of sufficient quality. Cycles of Zmpste24 should not be amplifying at the same time as we want them to be different.

A western blot was run using antibodies specific for GAPDH, a protein found in all cells. This is run as a control to make sure the same amount of protein was run in each lane. The antibodies were annealed to the membrane and proteins in the same way as before. Then 9ml of water and 1 ml of chemiluminescent was poured onto the membrane and left for 1 minute. The membrane was then put into a light-proof case and exposed with an AUTO-RAD sheet for 1 minute then developed. The resulting picture showed that there was the same amount of P.29 and P.30 protein loaded in the wells, in fact maybe a little more of the of the P.30.

1 colony had grown on the agar plate with both the vector and insert. Using a pipette tip the colony was scrapped and transferred into into 5ml of LB with 100 microG of ampicillin. This was then incubated over night at 37 degrees Celsius shaking.

3/12/2009 -

The Plasmid DNA was purified using the QIAprep spin mini-prep kit as per the provided protocol.

The purified DNA was then digested to check the insert had been incorporated into the plasmid, as follows:

2 microL DNA
2 microL H3 enzyme
2 microL H3 buffer
14 microL water

Then incubated at 37 degrees Celsius for 1 hour.

An electrophoresis gel was then ran using 5 microL of a 1kb+ ladder and 10 microL of the digested DNA. This was left to run at 110V for 1 hour.

The gel was then stained with ethidium bromide and a gel picture was taken. The vector and insert could not be seen, this may be due to a low concentration of DNA. A nanodrop was used to measure the DNA concentration:

-15.4 ng/microL

This is a very low yield usually you would expect a yield of around 200ng/microL using the QIAgen prep kit.


4/12/2009 -

Cells were counted using a haemocytometer. After counting it was seen there had been 2.4 population doublings. 300,000 cells were passaged to P.32.

The other flask was used to harvest cells to extract RNA and protein. This was done using the same method as previously.

7/12/2009 -

The clone with the low DNA yield was re-transformed. Three colonies were picked and transferred into LB + ampicillin and stored in the shaking incubator over night at 37 degrees Celsius.

8/12/2009 -

The DNA concentration of each of the three colonies was tested using the Nanodrop: -
1) 106.6 ng/microL
2) 123.9 ng/microL
3) 140 ng/microL

These concentrations meant there is a better yield of DNA and so a digestion would be more efficient.

Digestion of the plasmid DNA was done as follows: -

4 microL DNA
2 microL H3 buffer
2 microL H3 enzyme
12 microL water

This digestion was then run on a gel for 1 hour.

6 colonies of the re-transformed plasmids were put in LB and ampicillin and incubated over night at 37 degrees, shaking.

9/12/2009 -

DNA concentration of the 6 colonies (in ng/microL): -

1) 10.1
2) 6.3
3) 17.9
4) 10.6
5) 9.0
6) 14.0

These concentrations are too low to carry out a digestion.

9/12/2009 -

I met with Tracey to discuss how best to set out my report. We discussed how to set each part of the results into sections and to try and outline the project as soon as possible so results can be fitted in as we do the experiments.

Over the christmas holidays I will write up the introduction and begin the results using those we have collected already. I will also set out the outline for the rest of the report.

Thursday, 3 December 2009

Ligations, Plating, Western Blots and Taqman continued

27/11/09 -

A transformation for each ligation was set up as before, again using DHSalpha bacteria. Once plated the dishes were incubated at 37 degrees Celsius.

30/11/09 -

A western blot was run to test the quality of the Zmpste24 antibody. Two gels were used together, a lower gel and stack gel, to create a 10% acrylamide gel. The gel was made as follows:

Lower Gel:
- 3 ml acrylamide
- 2.5 ml resolving buffer (TRIS-SDS, pH 8.8)
- 4.5 ml water
- 50 microL APS
- 6.8 microL TEMED (a catalyst)

The lower gel was levelled using isopropenol which does not mix with the gel but will sit on top.

Once the gel has set pour off isopropenol.

Stacking Gel:
- 0.65 ml acrylamide
- 1.25 ml resolving buffer (pH6.8)
- 3 ml water
- 25 microL APS
- 5 microL TEMED

Pour over lower gel and leave to set.

The protein concentration of P.29 and P.30 was measured at approximately 2 microG/microL using a BIO-RAD protein assay which had been diluted 1 in 5 ( 200 microL BIO-RAD in 800 microL water).

25 microL of each protein (equal to 50 microG of protein) was loaded onto the gel along with 5 microL loading dye. A 10 microL sample from SW1353 cells was also loaded. The gel was run at 150V for 1 hour.

Once the gel had finished running the proteins were transferred to a PDVF membrane. This was done as follows:

- Wash membrane in methanol (be very careful to not touch membrane, even with gloved hands, use tweezers)
- Wash in transfer buffer to remove methanol
- Soak filters in transfer buffer
- Transfer one filter onto transfer blot
- Carefully place membrane on top of filter
- Place gel (with stack gel cut off) on top of membrane
- Place another soaked filter on top of the gel
- Place electrode over the top
- Run at 15v for 30 minutes

Once gel has run it needs to be stained with the primary and secondary antibodies. The primary antibody is specific for Zmpste24 and will stick to it on the membrane. The secondary antibody is specific for the primary antibody and will anneal to it. On the secondary antibody is a bioluminescent which will allow for the visualisation of the Zmpste24 protein on the membrane.

When the gel has finished running block in 6% milk (3g Marvel in PBS Tween, a buffer with detergent in it) for 1 hour.

Then the primary antibody is added. The membrane was left in the cold room at 4 degrees Celsius over night.

Once again no colonies had grown on the plates with the vector containing the insert. This could be due to my pipetting technique so we decided to run one more ligation and transformation with Tracey helping me to ensure the right concentrations are used. Only one ligation was done using 10microL of insert and 1 microL vector with the same concentrations of buffer and ligase as before. The final volume was brought to 20 microL using water. The ligation was incubated at 16 degrees Celsius over night in the PCR machine.

The vector only plate did have colonies this time. This shows the ligation is working.


1/12/09 -

The membrane with the primary antibody was washed in PBS Tween twice shaking each time for 5 minutes. The secondary antibody was then applied then washed with PBS Tween twice for 5 minutes, shaking.

Another transformation was done using the ligation made the previous day as well as the DNA made from the complimentary miR-34a positive control. The same method was used as before.

When the membrane had finished washing a chemiluminescent substrate (1ml mixed with 9 ml water to give a 1 in 10 dilution) was poured over the membrane and left for 1 minute.

The excess was drained off and the membrane put in a light proof cassette. Once in the dark room an Auto-RAD sheet was put in the light proof cassette and left to expose for 1 minute then developed.

We got a good exposure after 1 minute so decided to do another one for 10 minutes, which gave an even better picture.

The picture showed a clear band for Zmpste24 at 50kDa for both MRC5 P.29 and MRC5 P.30 cells where as no band could be seen for the SW1353 cells (although this may have been because we loaded a smaller volume for these cells). It appeared that P.30 cells had a lower concetration of Zmpste24 as the band was much lighter compared to that of the P.29. This may be because the protein concentration loaded was different but it may also be because the P.30 cells contain less Zmpste24.

To see whether the protein concentration loaded was the same we will strip the antibodies used for Zmpste24 and will re-stain for GAPDH, a protein found in all cells. If the bands are the same size when staining for GAPDH it means the same amount of protein was loaded.

The Zmpste24 antibodies were stripped using 0.2M NaOH which was poured over the membrane and left shaking for 5 minutes. The membrane was then washed with water then PBS Tween shaking for 5 minutes each time. Then the membrane was blocked in 6% milk for 1 hour. Once the membrane had finished blocking the GAPDH primary antibody was added and the membrane left in the cold room, shaking, over night.

Next, I worked with Caroline to carry out a Taqman experiment. Using Taqman will allow me to determine the level at which a number of cell lines are expressing Zmpste24 and will allow me to compare between healthy and cancer cell lines.

17 cell lines were used:


Caroline reverse transcribed the RNA in each of the samples to give cDNA. But the cDNA was too concentrated to use for Taqman so it needed to b diluted 1 in 20 which was done by using 10 microL cDNA in 190 microL water. The Taqman plate was loaded as follows:



2 microL of each sample was loaded into wells A1-C10 as shown above and then made up to 10 microL with water.
Wells E1-G10 were loaded with 10 microL of each sample as shown. Wells D3-8 were loaded with an 18S standard curve and wells H3-8 were loaded with a Zmpste24 standard curve. Then each well was made up to 25 microL with Mastermix, forward primer, reverse primer, water and either the 18S probe (wells A1-D8) or the Zmpste24 probe (wells E1-H8).

Once each well had been loaded the plate was put in the PCR machine and run for 1 and a half hours.







Wednesday, 2 December 2009

Ligations, Plating, Western Blots and Taqman

23/11/09 -

Agar plates were made up by melting agar which then had 100 microL ampicillin added. The agar + amp was poured into petri-dishes and left to set.

While the agar plates were setting a transformation for each ligation was set up as follows: -
- Add 10 microL ligation to 50 microL DHSalpha (competent bacteria which had been treated with calcium chloride)
- Leave on ice for 15 minutes
- Place in 40 degrees Celsius water bath for 1 minute
- Place on ice for 2 minutes
- Add 500 microL LB
- Incubate at 37 degrees Celsius for 45 minutes, shaking.
- Spin for 2 minutes at 13,000 rpm
- Remove most of the LB, leave about 100 microL
- Resuspend very gently
- Pipette onto agar plate and spread with sterile spreader
- Incubate over night at 37 degrees Celsius.

24/11/09 -

No colonies had grown on the vector only agar plates and only a few grew on the other plates.

These few colonies were picked and added with LB with 100 microL ampicillin added.
These were incubated over night at 37 degrees Celsius, shaking.

25/11/09 -

Another digest was carried out as before. The digested vectors were then phenol chloroform cleaned as before. The vector was then run on an electrophoresis gel to check it was present.

The band was cut out of the gel and purified using the same method as previously.

26/11/09 -

Worked in cell culture today with Alba Warn to passage my cells at a particular density. It was decided plating 300,000 cells per well was sufficient. By plating at a known density it will allow me to determine how many population doublings have occurred between each passage.

The cells were counted using a Hemocytometer.

Results:

65 cells over 5 sections of the hemocytometer
65/5 = 13
13 x 10,000 = 130,000
So, 130,000 cells per ml
Cells were resuspend in 5ml so, 650,000 cells in total.

Need to plate 300,000 cells so need to take 2.3ml and transfer to new flask. This allowed for two new flasks to be passaged into P.31. The final volume was made up to 10ml using medium.

The remaining P.30 cells were passaged to P.31 and will be left to become confluent. When the cells are confluent they will be harvested and frozen down in case the cells become infected again.

The other flask of P.30 cells was used to harvest protein and RNA as follows:

- Aspirate medium
- Wash with PBS
- Trypsinise
- Incubate for a few minutes
- Resuspend cells in 1ml PBS
- Transfer 500 microL into two eppendorfs (one for RNA extraction, one for protein extraction)
- Spin at 13,000 rpm for 5 minutes

The protein extraction was carried out as before. For the RNA extraction the pellet was resuspended in 500 microL of TRIzol and frozen for the extraction to be completed another day.

Another ligation was set up as follows: -

Ligation Insert Vector Ligase Buffer Water

μL
1 2 1 2 2 13
2 5 1 2 2 10
3 10 1 2 2 5
4 0 1 2 2 15


The complimentary sequence for miR-34a also arrived this week so we are now able to set up a positive control for the ligations

Firstly they need to be made into DNA, which will be treated the same way as a PCR product. This was done as follows:

- Add 10 microL of forward oligo to 10 microL of reverse oligo and 30 microL water
- Boil on hot block for 5 minutes
- Leave to cool naturally (this allows for strands to anneal and create DNA)

Saturday, 21 November 2009

Purification of DNA and Plasmid

06/11/09 -

Attended Lab meeting where I was able to update Dylan with the progress my project is making.

Cells were passaged:
P.34 and P.35 were given medium

10/11/09 -

7 flasks of my P.29 cells became infected and were thrown away.

13/11/09 -

Whilst carrying out her own experiments Tracey tested the expression of Zmpste24 in SW1353 cells and found it was highly expressed. Therefore we decided to extract and purify the Zmpste24 from these cells using the following method:

- Add 150 microL to 50 microL of the PCR product
- Add 200 microL of phenol cholorform
- Vortex for 5 seconds
- Centrifuge at 13,000 rpm for 10 minutes at 4 degrees Celsius
- Put the upper phase into a new eppendorf
- Add 500 microL 100% ethanol
- Add 20 microL sodium acetate
- Add 1 microL glycogen (this will act as a branching molecule which will grab the smaller fragments of DNA and bring them down into the pellet)
- Centrifuge at 13,000 rpm for 10 minutes at 4 degrees celcius
- Remove supernatant
- Add 500 microL 70% ethanol (do not resuspend)
- Spin as before
- Remove supernatant
- Leave to air dry (will take about 10 minutes if all dregs are removed)
- Resuspend in 100 microL water (as there was a big pellet)

The DNA was then stored at -20 degrees Celsius.

I met with Dylan to discuss my project and the next steps we will be taking. The first issue that needed to be addressed was whether to keep all my flasks of cells as I have too many. It was decided to keep P.35 and P.34 to extract the RNA at a later date, then keep at most two flasks of P.29 to keep passaging, harvesting RNA and Protein each time, keeping the flasks of cells to a maxium of 2. The rest could be thrown away. The cells will need to be split at a certain density so that we know how many population doublings have occurred in each passage, I will work with Alba to do this.

Over the next week or so I will also be working with Caroline Pennington to quantify the amount of Zmpste24 in the RNA I have already harvested and will also be looking at the amount of mir-34 and Zmpste24 in a number of cancer cell lines.

16/11/09 -

The purifyied Zmpste24 DNA was digested with the restriction enzyme HindIII to create sticky ends using the following method: -

Into an eppendorf tube add:-
- 80 microL PCR product (purified DNA from previous step)
- 10 microL HindIII buffer
- 10 microL HindIII enzyme

Incubate at 37 degrees Celsius for 3 hours.

I then harvested RNA from P.28 and P.29 cells using the same method as previously.

RNA concentration:

P.28 = 465 ng/microL (260/280 = 1.95, 260/230 = 1.26)
P.29 = 475 ng/microL (260/280 = 1.92, 260/230 = 1.28)

17/11/09 -

The digested DNA was then purified again using the phenol cholorform method.

100 microL of water was added to 100 microL of the product then the method was followed exactly as before.
The pellet was resuspended in 50 microL water.

The purified product was then run on a 1.5% agarose gel (made as before) to check if anything had been recovered. But as the gel was setting it had leaked making the gel very thin. After looking under UV light it no band could be seen.

The product was run again along with a 1kb + ladder and pmir report which will be used as the vector. This time a clear band could be seen.

19/11/09 -

All of my cells, except for two flask of P.29, became infected and had to be thrown away. It is thought to be because the medium contained no antibiotics.

Pen Strep antibiotics were added to my medium, then one flask of P.29 cells was passaged to two P.30 flasks. The cells from the other flask were harvested to extract protein as follows:

- Wash cells with 1 x PBS
- Add 1 ml PBS
- Scrape
- Transfer to an eppendorf tube
- Spin at 13,000 rpm for 5 minutes at 4 degrees Celsius
- Remove PBS
- Place pellet on ice
- Resuspend in RIPA buffer (use 3 x the volume of the pellet, in this case we used 100 microL)
(Ensure RIPA buffer has had a protease inhibitor tablet dissolved into it first)
- Leave on ice for 20 minutes
- Centrifuge at 10,000 rpm for 10 minutes at 4 degress Celsius
- Transfer supernatant to a new eppendorf
- Store at -20 degrees Celsius

An agarose gel containing the linearised plasmid was viewed under UV light to allow visualisation of the plasmid, which was then cut out of the gel and put into an eppendorf tube. The plasmid was then extracted using a QIAGEN extraction kit.

20/11/09 -

The DNA concentration of the Zmpste24 PCR product and the pmir report was measured using the nanodrop:

DNA concentration:
Pmir Reporter (which has been cut with HindIII) = 7.6 ng/micro L
Zmpste24 PCR product = 35.6 ng/microL

Four ligations were then set up to run over night.

The amount of insert was kept constant and a final volume of 20 microL was made up using water. The ligations were set up as follows:

1) 1 microL vector + 1 microL insert + 2 microL ligase + 2 microL buffer + 14 microL water
2) 5 microL vector + 1 microL insert + 2 microL ligase + 2 microL buffer + 10 microL water
3) 1 microL vector + 2 microL ligase + 2 microL buffer + 15 microL water
4) 5 microL vector + 2 microL ligase + 2 microL buffer + 11 microL water

Ligations 3 and 4 will act as controls.

The ligations were incubated at 16 degrees Celsius over night in the PCR machine.

Sunday, 8 November 2009

Continuing RT and PCR

30/10/09 -

Made an agarose gel consisting of 1.5% (0.75g) agarose with 50ml TBE buffer.

The samples were loaded into the gel with a 1kb ladder. It was run for 1 hour and then the gel was stained with ethidium bromide and was photographed using UV light. Unfortunately the PCR did not work as no DNA was present and only the primers appeared on the gel.

02/11/09 -

RNA was harvested from P.28 cells. This time the TRIzol was put directly into the flask of cells in the hope that this would lyse the cells more efficiently and ensure every cell is collected. This was done in the following way:

- Pour off medium
- Add PBS to wash
- Pour off PBS
**In fume hood**
- Add 1ml TRIzol
- Scrape cells into corner
- Add 500microL to two eppendorfs
- Add 250microL chloroform
-Vortex
Continue extraction process as described previously.

Using the nanodrop the RNA concentration was measured:

RNA concentration - 785.4ng/microL
260/280 - 1.87
260/230 - 0.78

260/280 and 260/230 are both measures of purity. The ideal value for 260/280 should be close to 2 and for 260/230 should be close to 1.

The RNA was then stored at -80 degrees Celsius.

03/11/09 -

cDNA was made from the RNA extracted from the P.28 cells using the same method as previously.

The cDNA was then stored in the freezer.

04/11/09 -

Another PCR reaction was set up in the same manner as before this time with three tubes containing 2 microL cDNA and one tube containing 4 microL cDNA. The final volume was made up to 50 microL using water.

The three tubes were again went through the PCR at three temperatures 50, 55 and 60 degrees Celsius. The tube with 4 microL cDNA was put through the PCR at 55 degrees.

Again I took photos of each flask of cells. Hopefully over time the ageing of the cells will be apparent through these photographs.

05/11/09 -

A 1.5% agarose gel was made and the samples were run for an hour along with a 1kb ladder. The gel was stained with ethidium bromide and photographed under UV light.

Again the PCR did not work, only the primers an primers which had dimerised showed up on the photograph.

This may be because the MRC-5 cells have a low expression of Zmpste24 or that the binding site is right at the end of the 3' UTR and the primers are not binding very well. The next step is to look at the expression of Zmpste24 in these cells as well as a number of other cell lines.

06/11/09 -

Passaged 11 P.28 to 22 P.29 and 2 P.27 to 4 P.28
New medium was added to P.34 and P.35

Tuesday, 3 November 2009

Harvesting RNA and beginning Reverse Transcriptase and PCR

23/10/09 -

One of the P.26 passage became infected so contents were washed with Trigene to disinfect it and kill everything within, then the contents was disposed of.

After checking cells it was seen that one of the P.34 passages is now senescent. These cells can be seen as they differ from the normal fibroblast cells which are long and thin, where as the senescent cells are flatter, rounder and more relaxed. They are quite noticably different from the dividing cells. The cells were given new medium. P.35 and one P.26 flask were given new medium where as the other 3 of the P.26 flask were passaged to P.27.

Each time the cells are passaged it is a population doubling and the cells are ageing. I will keep passaging the cells to age them and encourage them into senescence while at the same time periodically harvesting RNA.

RNA was harvested from one P.26 passage and one P.35 passage. The same method was done for each passage. This was done as follows: -

- Pour medium away, leaving a little bit in the flask. - using a scraper scrap cells into the corner (you can see the cells moving as they begin to clump together)

- Once you are confident all cells have been scraped off the surface use pipette remaining medium into an eppendorf tube

- Spin tubes to form a pellet

- Remove supernatant

- Resuspend pellet in 1ml of PBS buffer

- Take 2 eppendorf tubes and add 500microL of the buffer mixture

-Centifuge

**Must remember to use green gloves when using TRIzol as it is phenol based**

Then inside a fume hood: -

-Resuspend one of the pellets in 500microL TRIzol and pipette into the other tube, resuspending that pellet

Cells were then frozen and the RNA will be extraced on Monday.

The miR-34a and the miR-34c-5p binding sites within the Zmpste24 binding site have been identified using microRNA.org. It was shown that the binding site is right at the end of the 3'UTR beginning at position 1481. Using the 3'UTR sequence, the binding site has been identified as:

TGAAACATTAAACATTGCCA

Tracey and I discussed the vector we will be using in the cloning. Tracey has previously had success using the Pmir report vector :




We will use only one restriction enzyme (HindIII) to cut the vector. This will allow the gene to be inserted in either orientation, which acts as a control.

The hindIII restriction enzyme recognises and cuts at the following sequence:

This sequence will then have a primer sequence that we will design attached in the 5'-3' direction. At the 5' end we will also attach a short extra sequence, for example GACA, which provide an area for the restriction enzyme to bind. The same process will be done for the other strand aswell.


27/10/09-

The RNA extraction was continued as follows: -

**In fume hood**

- Add 200microL choloform

- Vortex (to mix contents)

- Centrifuge at 13000 rpm for 10 minutes in cold room ( 4 degrees Celsius)

This process will give three phases, the top phase will be RNA, the middle protein and other organic material and the bottom DNA

- Remove top layer, very carefully, and pipette into new eppendorf tube

- Add 500microL isopropenol (which precipitates the RNA into a pellet)

- Leave at room temperature for 5 minutes

- Centrifuge at 13000 rpm for 10 minutes in cold room

-Remove supernatant

- Wash with 70% ethanol, do not resuspend the pellet

- Centrifuge for 10 minutes at 13000 rpm in cold room

- Remove ethanol, use smaller pipette to get rid of dregs

- Leave to air dry

- Resuspend pellet in 20microL in water

The RNA concentration was then measured using the nanodrop. The nanodrop is first blanked with water to callibrate it. Then one microL of each sample is measured.

For a useable sample the minimum amount of RNA wanted is 100ng/microL

Results: -

P.26 = 0.7ng/microL

P.35 = 76ng.microL

P.26 RNA concentration was much to low to use, where as P.35 was just acceptable. The reverse transcription gives 836ng in 11 microL of solution, so it was decided to use this RNA in the PCR reaction.

I also took photos of each flask of cells. This will allow us to record any changes in the appearance of the cells.

29/10/09

First I needed to created the complimentary DNA sequence (cDNA), this was done by using reverse transcriptases, a process which assumes 100% efficieny and so gives 1 microgram of cDNA.

**On ice**

- Add 10 microL RNA to 1 microL oligo dT primers

(These primers put tags which attach to the polyA tails on the ends of the RNA, during the reverse transcriptase process these primers will elongate and prime only the messages, as these are the only RNA which have polyA tails.)

- Incubate at 70 degrees Celsius for 10 minutes

- On ice add:

4 microL 5 X first strand synthesis buffer

2 microL DTT

1 microL dNTPs

2 microL RNase Inhibitor (there is RNase everywhere, on fingers etc. so we need the inhibitor to prevent the RNA being degraded)

- Incubate for 2 minutes at 42 degrees Celsius

- Add 1 microL superscript

- Incubate for one hour at 42 degrees Celsius, then at 70 degrees Celsius for 10 minutes.

New medium was added to P.34 and P.35. The P.35 flask is showing signs of senescence aswell. I will monitor these cells and take pictures to note any differences.

P.26 was passaged to P.27

6 flasks of P.27 were passaged to 12 flasks of P.28


Now we have cDNA a PCR can be carried out to amplify the DNA. This was done as follows:

- In a PCR tube add:

2 microL cDNA

5 microL acutaq buffer

1 microL dNTP

1 microL of each primer (forward and reverse)

1 microL acutaq (a DNA polymerase which decreases the rate of mutation)

The 3 PCRs were carried out over night at 3 different temperatures 50 degrees Celsius, 55 degrees Celsius and 60 degrees Celsius.


Thursday, 22 October 2009

Bioinformatics

08/10/09 -
P.24 cells are growing well and are confluent, so were passaged from P.24 to P.25. P.33 cells are growing more slowly, which is usual for human fibroblast cells so new medium was added.

09/10/09 -
P.33 cells passaged to P.34

14/10/09 -
Met with Dylan Edwards (my supervisor) and Tracey Swingler, a postdoctoral research associate in Ian Clarke's research group who will be helping me with my project. Tracey is working on the identification and characterisation of microRNAs involved in chondrogenesis and osteoarthritis, so is experienced in studying microRNAs. I arranged to meet with Tracey on 16/10/09 to discuss my project.

16/10/09 -
The first part of showing a link between zmpste24 and miR-34 is to use bioinformatics to show a theoretical binding site for miR-34 on zmpste24. Tracey demonstrated how to use software such as TargetScan, Pictar, mirbase
to find targets for miR-34 or to find all miRNA targets for a protein.
Passaged cells from P.25 to P.26 and passaged one flask of P.34 cells to P.35, but the other flask of P.34 cells had not grown as quickly so new medium was added.

17/10/09-19/10/09 -
Searched through bioinformatics databases. Zmpste24 did not show a binding site for miR-34 in either the well conserved or poorly conserved sites in any of the databases I checked (targetscan, pictar and microRNA.org). Targetscan brought up 114 miRNA targets for Zmpste24 and microRNA.org produced 3,022 theoretical gene targets for miR-34. This may be due to the fact that these databases are constantly being updated and it may have caused zmpste24 to have been lost from the list of gene targets for miR-34, especially if it is a poorly conserved site.

20/10/09 -
Met with Dylan and Tracey to discuss problem of not finding zmpste24 in the databases. When searching the databases lamin A/C came up as a gene target for miR-34, so it was decided to use the lamin A/C protein in the probes instead. Zmpste24 regulates lamin A/C so inhibition of lamin A/C has the same effect on the cells and will produce the same senescence phenotype. Tamas Dalmay, who works with microRNAs investigating their roles in various projects, suggested looking through the sequence of the 3'-UTR of Zmpste24, which can be found using the database Ensembl, to find the miR-34 seed sequence. It is unlikely I will be able to find this sequence as the binding site in Zmpste24 will not be perfectly complimentary, so I could be looking for a number of different combinations of the sequence with any of the bases included.

I looked through the databases again and found on microRNA.org a potential binding site for miR-34 on Zmpste24, starting at bp 1481. I also found the splice variant of lamin A/C which has the longest 3'-UTR using Ensembl. I can use this information and try to find the miR-34 seed sequence with in it.

Tracey and I have decided to start extracting RNA from my cells on 23/10/09, the RNA can be frozen until we are ready to use it. I will also be taking pictures of the cells I have grown which will allow us to visualise the difference between senescent and non-senescent cells.

21/10/09 -
I have had a brief look at the literature to try and establish which form or miR-34 (a, b or c, *,5p or 3p) is the most abundant or shows an effect. So far it seems miR-34a is the most abundant and commonly used form in experiments, but miR-34c is also used. More reading is needed to make a more informed decision.

Wednesday, 7 October 2009

Inductions and beginning to grow tissue

29/09/2009

Today I had the building induction in the Biomedical Research Centre (BMRC) with Alba Warn. Alba took me through all health and safety procedures and took me around the lab showing me where each research group works, the communal areas, waste disposal, first aid kits and fire exits. Main points to note were:

Chief Technicians - Alba Warn & Jasmine Waters
Emergency Evacuation Procedures - Follow signs to Fire Exits
Alert others by striking 'break glass' boxes to set alarm
Assembly points: Across DMU loading bay for East Wing, and grass between BMRC and Sainsbury Centre for West Wing.
First aid information is on posters at each end of the lab
Labcoats to be worn at all times, along with gloves, goggles, face visor as appropriate (e.g. wear face visor and protective gloves when handling liquid nitrogen).

01/10/2009

Today was my induction to the tissue culture lab, again with Alba Warn. I was shown where all equipment for the Edwards lab and all communal equipment is held. Important points to note:
- Hoods need to be cleaned before and after each use with trigene
- Anything brought into the hood must be disinfected with trigene before it is brought in.
- Lab coats must be worn at all times in the tissue culture lab. This lab coat is kept in the lab.
- Hoods should be booked before hand, and as a matter of courtesy if you finish early, or think you will finish late you should let the next person know.

02/10/2009

I began to grow my cells with Alba. I began by creating my medium by adding L glutamine and foetal calf serum (FCS) to the medium provided. Then added this to cells from passage 23 and 32 which had been stored in liquid nitrogen. These cells were then transferred into small flasks and incubated at 37 degrees celcius.

I also attended the Edwards research group lab meeting and met the other members of the research group.

05/10/2009

Cells were passaged from P23 to P24 and P32 to P33. This was done by first aspirating the medium from the flask, washing with PBS buffer, aspirating again, then washing with TE to remove the cells from the matrix. The cells were transferred to larger flasks along with 10ml of the medium created previously. The cells were incubated again.

07/10/2009

The cells have been growing well but were not yet confluent so today I added fresh medium to feed the cells. I have incubated the cells again and will check on them again tomorrow and decide whether they need to be fed again or to be passaged again.

Tuesday, 29 September 2009

Investigation of a link between microRNAs, cell senescence and Cancer

Background and Rationale

MicroRNAs (miRNAs) are small, single-stranded RNA molecules roughly 21-25 nucleotide long which negatively regulate gene expression. They have been shown to control cell growth, differentiation, and apoptosis. MiRNAs work in one of two ways to regulate gene expression, if the miRNA is perfectly, or near perfectly, complementary to the 3’-untranslated region (3’UTR) of the mRNA the RNA interference (RNAi) pathway is induced and the mRNA is cleaved by ribonucleases found in RISC (RNA-induced silencing complex) causing the mRNA to be degraded. The second mechanism of regulation occurs when the miRNA is only partially complimentary to the 3’-UTR of the mRNA. This method does not involve the degradation of the mRNA but represses the expression of the gene post-transcriptionally, and therefore prevents the mRNA transcript being translated, again using RISC. Through this method the level of the target protein decreases but the level of mRNA remains unchanged, with the first method both the level of mRNA and the level of protein decreases.

MiRNAs have been shown to function as both tumour suppressors and oncogenes, as they are able to act as both activators and inhibitors depending on the type of gene the miRNA is acting upon. If the miRNA acts as an inhibitor on an oncogene it is then acting as a tumour suppressor, conversely if the miRNA acts as an inhibitor on a tumour suppressor gene, it is inhibiting an inhibitor and therefore causing it to become an oncogene. Therefore this suggests a strong link between miRNAs and tumour formation. Lu et al (2005) observed a down regulation of certain miRNAs in tumours compared to normal tissue, this observation highlights the link between miRNAs and tumour formation and shows a potential for miRNA profiling in cancer diagnosis. He et al (2006) further proved this link after studying B cell lymphomas and a cluster of miRNAs, the miR-17-92 polycistron. It was observed that primary or mature miRNAs derived from this polycistron are substantially increased in B cell lymphomas compared to normal tissues. It was observed that when the expression of the miR-17-92 cluster was enforced, it acted with c-myc expression (a proto-oncogene which encodes a transcription factor that regulates cell proliferation, growth and apoptosis) and tumour development was accelerated in mouse B cell lymphoma models. He et al came to the conclusion that these studies indicate that miRNAs can modulate tumour formation, and that the miR-17-92 cluster is implicated as a potential human oncogene.



Example of how miRNAs act as tumour suppressors and oncogenes, taken from Caldas and Brenton (2005), Sizing up miRNAs as cancer genes.

Esquela-Kerscher and Slack produced a review in Nature (2006) detailing oncomirs, miRNAs with a role in cancer. In this review it was described that about 50% of annotated human miRNAs are located in regions of the genome, known as fragile sites, which are associated with cancer, again indicating that miRNAs might have a crucial function in tumourigenesis. Calin et al (2002) were one of the first groups to indicate miRNAs acted as tumour suppressors by studying patients diagnosed with B-cell chronic lymphocytic leukaemia (B-CLL), a common form of adult leukaemia. It was observed that in more than half these patients there were deletions or down-regulations of two clustered miRNA genes, miR-15a and miR-16-1.

P53 is a gene which encodes a transcription factor, that is involved in multiple cellular processes and regulates the cell cycle. It acts as a sensor for many cancer-associated stress signals, including DNA damage, telomere depletion and oncogene stress, and therefore functions as a tumour suppressor. P53 has been described as the guardian of the genome as it conserves stability by working to prevent mutations. P53 is able to detect DNA damage and work to repair it if possible by initiating survival pathways. If the damage to the DNA is too severe p53 is able to stop the cell cycle and move the cell into programmed cell death by inducing the apoptotic pathways. This shows that although p53 is mainly a transcriptional activator it also has the ability to work as an inhibitor, for example inhibiting apoptosis for a cell to survive. Mutations in p53 are associated with rapid tumour progression, with p53 being mutated in roughly 50% of cancers.


The p53 tumour suppressor network, taken from He et al (2007), The guardian’s little helper: MicroRNAs in the p53 tumour suppressor network.

Recent studies have highlighted miR-34 as a microRNA component of the p53 network. He et al (2007, a microRNA component of the p53 tumour suppressor network) is a key study in the establishment of MicroRNAs in the p53 tumour suppressor network. Wild type cells were compared with p53-deficient cells for miRNA expression, and it was found that expression of the miR-34 family of miRNA was related to p53 status. This allowed for the identification of miR-34s as an important p53 transcriptional target, which is able to regulate cell proliferation and apoptosis. The miR-34 family of miRNAs are directly induced by p53 in response to oncogenetic stress and DNA damage (illustrated in the figure above); this induction then blocks other functions such of that of BCL2 and the apoptotic molecules and Cyclin-Dependent Kinase 6 (CDK6) which is involved in cell cycle transit. MiR-34 reiterates the effects of p53 by inducing growth arrest and apoptosis by inhibiting the expression of pro-proliferation and anti-apoptotic genes. Extensive studies have been carried out to ascertain the regulation of miR-34 family by p53; both exogenous and physiological stresses are capable of miR-34 expression in a p53-dependent manner both in vivo and in vitro.

The following figure is adapted from He et al (2007, MicroRNAs join the p53 network – another piece in the tumour suppression puzzle) and shows the relationship between p53 and miR-34 and their roles in regulating cell proliferation and cell death.

MiR-34 has also been reported to be deleted in some human cancers. MiR-34a is located at 1p36, a region of frequent heterozygous deletion in many tumour types, as shown by Versteeg, R et al (1995). Minimal deletions containing miR-34b and miR-34c have also been shown in lung and breast cancer, evidence of which was observed by Calin et al (2004).

Normal human cells (i.e. not stem cells) don’t have telomerase activity, and so with every division telomeres at the end of chromosomes become smaller and smaller until they get to a stage where they are too small for the cell to divide anymore, at this point the cell is still viable but no longer dividing and has reached the stage of senescence. This uses the activation of critical tumour suppressor genes, namely p53. This process happens as the cell ages, the older the cell becomes the shorter telomeres become, and is recognised as an anti-cancer defence. The older a cell is the more susceptible the DNA is to damage, so the cell shuts down to stop the damage being passed on and therefore preventing tumour progression. Kumamoto, K et al (2008) observed that Nutlin-3a, an MDM2 inhibitor, is able to activate p53 to induce apoptosis in many types of cancer cells. Nutlin-3a is able to induce senescence by both activating and inhibiting a number of p53 dependent genes, including activating miR-34a, miR-34b and miR-34c and down-regulating inhibitor of growth 2 (ING2). Studying normal human fibroblasts and using chromatin immunoprecipitation, electrophoretic shift assays and monitoring Luciferase activity, Kumamoto and colleagues came to the conclusion that nutlin-3a induces senescence through p53 activation in normal human fibroblasts, as well as concluding that p53-mediated miR-34a; miR-34b and miR-34c up-regulation and ING2 down-regulation may be involved in the senescence pathway.

Metalloproteinases are a group of enzymes which have protease activity, allowing them to cleave protein. Metalloproteinases work on the cell surface where they were thought to cut a path for the cancer cell to move through the extracellular matrix, but these proteases have very complex functions and it is not fully understood what function they perform.

Zmpste24 is a different sort of metalloproteinase which works inside the cell, as first observed by Carlos Lopez-Otin (2002). Zmpste24 is involved in the process of the maturation of nuclear lamin A which provides structural support and transcriptional regulation of the nuclear lamina, and therefore is an essential part of the nuclear lamina. Zmpste24 deficient mice exhibit accelerated aging and have severe nuclear structure abnormalities leading to a shortened life-span, as shown by Lopez-Otin et al (2005, Accelerated ageing in mice deficient in Zmpste24 protease is linked to p53 signalling). A similar phenomenon is observed in humans, with Zmpste24 knock out humans suffering from Hutchinson Gilford Progeria Syndrome (HGPS), a condition that causes sufferers to exhibit accelerated aging. Lopez-Otin and colleagues decided to investigate the molecular mechanism that underlies these diseases. It was demonstrated that the Zmpste24 deficiency induces a stress signalling pathway that was discovered through an up-regulation of p53 target genes and a senescence phenotype at the cellular level and accelerated aging for the organism. It was also demonstrated that this phenotype could be rescued by re-introducing Zmpste24 in Zmpste24-/-, lamina+/- mice, and partially rescued in mice deficient in both lamin A and Zmpste24. These observations allowed Lopez-Otin to come to the conclusion that there is a checkpoint response which is activated by nuclear abnormalities caused by prelamin A accumulation, which also supports the theory that hyperactivation of p53 may cause accelerated aging.

The gap in the science that has been identified is whether Zmpste24 is a target of miRNAs, specifically the miR-34 family.

Hypothesis

Therefore from reading the literature I will be testing the hypothesis that the following pathway is correct:


Design and Methodology

During the research project I will be undertaking at least 5 experiments to test my hypothesis and will investigate the roles miR-34 and Zmpste-24 have in senescence and cancer. The experiments will be as follows:
1. Effect of miR-34 on endogenous Zmpste24 mRNA and protein

2. - Construct Luciferase reporter with 3’-UTR region of Zmpste-24 (containing putative miR-34)

- Transfect miR-34 and scrambled (mutated) control into vectors. Does miR-34 suppress reporter activity?

3. Mutate putative miR-34 site. Does this wipe out miR-34 suppression in the reporter?

4. Is there a relationship between miR-34 and Zmpste-24 in cancer cell lines

5. How does this relationship relate to p53 status?


A western blot will be used to investigate the effect of miR-34 on endogenous Zmpste24 protein in experiment to determine the concentration of Zmpste24 protein within the cell. This method is used as it allows a clear and easy comparison of the different concentrations of protein when different amounts of miR-34 are available.

In experiment 2 the reporter gene, Luciferase, will be transfected into cells and the activity will be measured. When Luciferase is active, i.e. the reporter gene has been turned on, light will be emitted. An extract of cells will be incubated in a luminometer which is able to measure the level of light. Luciferase is used over other reporter genes, for example GFP (green fluorescent protein) as it is a convenient assay system which can be easily manipulated and is widely used for these types of experiments. This method will also be used over other methods as the Biomedical Research Laboratory has a luminometer.

In each of these experiments I will be using normal, non-senescent human fibroblasts; most likely MRC-5 cells and I will be using the Targetscan program to determine the miR34 site.

Data Summaries and Analyses

Western blotting uses a gel which can be stained and then photographed to allow the different concentrations of protein to be visualised, when there is a bigger concentration of protein the band will be darker than a lesser concentration, the blot will be similar to:


Which has been adapted from Eulalio, A et al (2008) who used a western blot to show that GW182 interaction with argonaute is essential for miRNA mediated translational repression and mRNA decay.

Raw data from each of the experiments will be held in excel tables, these will then be used to construct histograms and line graphs as appropriate. The raw data will also be used in a standard T-Test which will allow me to statistically test whether my observations are significant and therefore whether my hypothesis is correct. Other statistical tests may be applied as appropriate, depending on the nature of the data generated. An example of how I will use data obtained from my experiments is shown using dummy data for experiment 2, below.

Concentration of miR-34 (µg)

Relative Light Units (x1000)

0

700

0.1

623

0.2

587

0.3

504

0.4

466

0.5

379

0.6

297

0.7

243

0.8

198

0.9

105

1

62

Mean of dummy data: 378.5

Standard Deviation of dummy data: 0.22

Planning Schedule

Experiment

Semester

Week(s)

1

1

2 - 4

2

1

4 - 8

3

1

8 - 12

4

2

1 - 4

5

2

4 - 7

As my research project is comprised of many smaller experiments instead of one long one they will be carried out over the two semesters, and therefore parts of my final project report and presentation will not be completed at a certain time, but on going as I complete each experiment. The components of my report that will be carried out continuously and the other components which have a more set time scale are shown in the table below.

Component

Date intended to carry out task

Literature Search

SEM1 WK 1-6

Testing Methodology

SEM1 WK 2-4

Preliminary Studies

ONGOING AS PER EXPERIMENT TIMETABLE

Data Collection

ONGOING THROUGHOUT YEAR

Preparation of Progress Report

SEM1 WK 4-7

Data Analyses (Expt 1 - 3)

ONGOING THROUGH SEMESTER 1

Data Analyses (Expt 4- 5)

ONGOING THROUGH SEMESTER 2

Preparation of first draft of written report

EASTER BREAK - SEM2 WK 1

Drafting written report

SEM2 WK 2-5

Preparation of oral presentation

SEM2 WK 5-9

Component

Submission Deadline

1st blog assessment

SEM1 WK 1-2

2nd blog assessment

SEM1 WK 11-12

3rd blog assessment

SEM2 WK 3-4

Submit report

SEM2 WK 9

Presentation

SEM2 WK 9

I have produced a Gantt chart to illustrate more clearly the time periods over which each component of the project will be carried out. The Gantt chart is present in days, with day 0 being Monday SEM1 WK1 (21/9/09). I have designed my Gantt chart so it does not include weekends or holidays, therefore a week is presented as 5 days. Using this method the project is scheduled to end on day 100, which is Monday SEM 2 WK 9 (08/03/10), as this is the deadline for both the completed report and the presentation.

The project may potentially be disrupted if the cloning in experiment two does not work correctly. Successfully cloning a vector which has been transfected with new genes is a very rare event, and quite often the genes will not be transfected properly and therefore no reporter activity will be present. If this happens this part of the experiment needs to be repeated until an adequate amount of cells show successful transfection.

Relevance

This project is relevant to the wider field of cancer biology as if the results confirm my hypothesis it will give a wider understanding of the process of senescence, more specifically senescence as an anti-cancer defence. This potentially could allow for drugs to be developed which mimic miR-34 function, inhibiting Zmpste24 function causing the cell to become senescent.