Ligations, Plating, Western Blots and Taqman continued

27/11/09 -

A transformation for each ligation was set up as before, again using DHSalpha bacteria. Once plated the dishes were incubated at 37 degrees Celsius.

30/11/09 -

A western blot was run to test the quality of the Zmpste24 antibody. Two gels were used together, a lower gel and stack gel, to create a 10% acrylamide gel. The gel was made as follows:

Lower Gel:

- 3 ml acrylamide

- 2.5 ml resolving buffer (TRIS-SDS, pH 8.8)

- 4.5 ml water

- 50 microL APS

- 6.8 microL TEMED (a catalyst)

The lower gel was levelled using isopropenol which does not mix with the gel but will sit on top.

Once the gel has set pour off isopropenol.

Stacking Gel:

- 0.65 ml acrylamide

- 1.25 ml resolving buffer (pH6.8)

- 3 ml water

- 25 microL APS

- 5 microL TEMED

Pour over lower gel and leave to set.

The protein concentration of P.29 and P.30 was measured at approximately 2 microG/microL using a BIO-RAD protein assay which had been diluted 1 in 5 ( 200 microL BIO-RAD in 800 microL water).

25 microL of each protein (equal to 50 microG of protein) was loaded onto the gel along with 5 microL loading dye. A 10 microL sample from SW1353 cells was also loaded. The gel was run at 150V for 1 hour.

Once the gel had finished running the proteins were transferred to a PDVF membrane. This was done as follows:

- Wash membrane in methanol (be very careful to not touch membrane, even with gloved hands, use tweezers)

- Wash in transfer buffer to remove methanol

- Soak filters in transfer buffer

- Transfer one filter onto transfer blot

- Carefully place membrane on top of filter

- Place gel (with stack gel cut off) on top of membrane

- Place another soaked filter on top of the gel

- Place electrode over the top

- Run at 15v for 30 minutes

Once gel has run it needs to be stained with the primary and secondary antibodies. The primary antibody is specific for Zmpste24 and will stick to it on the membrane. The secondary antibody is specific for the primary antibody and will anneal to it. On the secondary antibody is a bioluminescent which will allow for the visualisation of the Zmpste24 protein on the membrane.

When the gel has finished running block in 6% milk (3g Marvel in PBS Tween, a buffer with detergent in it) for 1 hour.

Then the primary antibody is added. The membrane was left in the cold room at 4 degrees Celsius over night.

Once again no colonies had grown on the plates with the vector containing the insert. This could be due to my pipetting technique so we decided to run one more ligation and transformation with Tracey helping me to ensure the right concentrations are used. Only one ligation was done using 10microL of insert and 1 microL vector with the same concentrations of buffer and ligase as before. The final volume was brought to 20 microL using water. The ligation was incubated at 16 degrees Celsius over night in the PCR machine.

The vector only plate did have colonies this time. This shows the ligation is working.

1/12/09 -

The membrane with the primary antibody was washed in PBS Tween twice shaking each time for 5 minutes. The secondary antibody was then applied then washed with PBS Tween twice for 5 minutes, shaking.

Another transformation was done using the ligation made the previous day as well as the DNA made from the complimentary miR-34a positive control. The same method was used as before.

When the membrane had finished washing a chemiluminescent substrate (1ml mixed with 9 ml water to give a 1 in 10 dilution) was poured over the membrane and left for 1 minute.

The excess was drained off and the membrane put in a light proof cassette. Once in the dark room an Auto-RAD sheet was put in the light proof cassette and left to expose for 1 minute then developed.

We got a good exposure after 1 minute so decided to do another one for 10 minutes, which gave an even better picture.

The picture showed a clear band for Zmpste24 at 50kDa for both MRC5 P.29 and MRC5 P.30 cells where as no band could be seen for the SW1353 cells (although this may have been because we loaded a smaller volume for these cells). It appeared that P.30 cells had a lower concetration of Zmpste24 as the band was much lighter compared to that of the P.29. This may be because the protein concentration loaded was different but it may also be because the P.30 cells contain less Zmpste24.

To see whether the protein concentration loaded was the same we will strip the antibodies used for Zmpste24 and will re-stain for GAPDH, a protein found in all cells. If the bands are the same size when staining for GAPDH it means the same amount of protein was loaded.

The Zmpste24 antibodies were stripped using 0.2M NaOH which was poured over the membrane and left shaking for 5 minutes. The membrane was then washed with water then PBS Tween shaking for 5 minutes each time. Then the membrane was blocked in 6% milk for 1 hour. Once the membrane had finished blocking the GAPDH primary antibody was added and the membrane left in the cold room, shaking, over night.

Next, I worked with Caroline to carry out a Taqman experiment. Using Taqman will allow me to determine the level at which a number of cell lines are expressing Zmpste24 and will allow me to compare between healthy and cancer cell lines.

17 cell lines were used:

Caroline reverse transcribed the RNA in each of the samples to give cDNA. But the cDNA was too concentrated to use for Taqman so it needed to b diluted 1 in 20 which was done by using 10 microL cDNA in 190 microL water. The Taqman plate was loaded as follows:

2 microL of each sample was loaded into wells A1-C10 as shown above and then made up to 10 microL with water.
Wells E1-G10 were loaded with 10 microL of each sample as shown. Wells D3-8 were loaded with an 18S standard curve and wells H3-8 were loaded with a Zmpste24 standard curve. Then each well was made up to 25 microL with Mastermix, forward primer, reverse primer, water and either the 18S probe (wells A1-D8) or the Zmpste24 probe (wells E1-H8).

Once each well had been loaded the plate was put in the PCR machine and run for 1 and a half hours.

Ligations, Plating, Western Blots and Taqman

23/11/09 -

Agar plates were made up by melting agar which then had 100 microL ampicillin added. The agar + amp was poured into petri-dishes and left to set.

While the agar plates were setting a transformation for each ligation was set up as follows: -
- Add 10 microL ligation to 50 microL DHSalpha (competent bacteria which had been treated with calcium chloride)
- Leave on ice for 15 minutes
- Place in 40 degrees Celsius water bath for 1 minute
- Place on ice for 2 minutes
- Add 500 microL LB
- Incubate at 37 degrees Celsius for 45 minutes, shaking.
- Spin for 2 minutes at 13,000 rpm
- Remove most of the LB, leave about 100 microL
- Resuspend very gently
- Pipette onto agar plate and spread with sterile spreader
- Incubate over night at 37 degrees Celsius.

24/11/09 -

No colonies had grown on the vector only agar plates and only a few grew on the other plates.

These few colonies were picked and added with LB with 100 microL ampicillin added.
These were incubated over night at 37 degrees Celsius, shaking.

25/11/09 -

Another digest was carried out as before. The digested vectors were then phenol chloroform cleaned as before. The vector was then run on an electrophoresis gel to check it was present.

The band was cut out of the gel and purified using the same method as previously.

26/11/09 -

Worked in cell culture today with Alba Warn to passage my cells at a particular density. It was decided plating 300,000 cells per well was sufficient. By plating at a known density it will allow me to determine how many population doublings have occurred between each passage.

The cells were counted using a Hemocytometer.

Results:

65 cells over 5 sections of the hemocytometer
65/5 = 13
13 x 10,000 = 130,000
So, 130,000 cells per ml
Cells were resuspend in 5ml so, 650,000 cells in total.

Need to plate 300,000 cells so need to take 2.3ml and transfer to new flask. This allowed for two new flasks to be passaged into P.31. The final volume was made up to 10ml using medium.

The remaining P.30 cells were passaged to P.31 and will be left to become confluent. When the cells are confluent they will be harvested and frozen down in case the cells become infected again.

The other flask of P.30 cells was used to harvest protein and RNA as follows:

- Aspirate medium
- Wash with PBS
- Trypsinise
- Incubate for a few minutes
- Resuspend cells in 1ml PBS
- Transfer 500 microL into two eppendorfs (one for RNA extraction, one for protein extraction)
- Spin at 13,000 rpm for 5 minutes

The protein extraction was carried out as before. For the RNA extraction the pellet was resuspended in 500 microL of TRIzol and frozen for the extraction to be completed another day.

Another ligation was set up as follows: -

Ligation	Insert	Vector	Ligase	Buffer	Water
	μL
1	2	1	2	2	13
2	5	1	2	2	10
3	10	1	2	2	5
4	0	1	2	2	15

The complimentary sequence for miR-34a also arrived this week so we are now able to set up a positive control for the ligations

Firstly they need to be made into DNA, which will be treated the same way as a PCR product. This was done as follows:

- Add 10 microL of forward oligo to 10 microL of reverse oligo and 30 microL water
- Boil on hot block for 5 minutes
- Leave to cool naturally (this allows for strands to anneal and create DNA)

Purification of DNA and Plasmid

06/11/09 -

Attended Lab meeting where I was able to update Dylan with the progress my project is making.

Cells were passaged:
P.34 and P.35 were given medium

10/11/09 -

7 flasks of my P.29 cells became infected and were thrown away.

13/11/09 -

Whilst carrying out her own experiments Tracey tested the expression of Zmpste24 in SW1353 cells and found it was highly expressed. Therefore we decided to extract and purify the Zmpste24 from these cells using the following method:

- Add 150 microL to 50 microL of the PCR product
- Add 200 microL of phenol cholorform
- Vortex for 5 seconds
- Centrifuge at 13,000 rpm for 10 minutes at 4 degrees Celsius
- Put the upper phase into a new eppendorf
- Add 500 microL 100% ethanol
- Add 20 microL sodium acetate
- Add 1 microL glycogen (this will act as a branching molecule which will grab the smaller fragments of DNA and bring them down into the pellet)
- Centrifuge at 13,000 rpm for 10 minutes at 4 degrees celcius
- Remove supernatant
- Add 500 microL 70% ethanol (do not resuspend)
- Spin as before
- Remove supernatant
- Leave to air dry (will take about 10 minutes if all dregs are removed)
- Resuspend in 100 microL water (as there was a big pellet)

The DNA was then stored at -20 degrees Celsius.

I met with Dylan to discuss my project and the next steps we will be taking. The first issue that needed to be addressed was whether to keep all my flasks of cells as I have too many. It was decided to keep P.35 and P.34 to extract the RNA at a later date, then keep at most two flasks of P.29 to keep passaging, harvesting RNA and Protein each time, keeping the flasks of cells to a maxium of 2. The rest could be thrown away. The cells will need to be split at a certain density so that we know how many population doublings have occurred in each passage, I will work with Alba to do this.

Over the next week or so I will also be working with Caroline Pennington to quantify the amount of Zmpste24 in the RNA I have already harvested and will also be looking at the amount of mir-34 and Zmpste24 in a number of cancer cell lines.

16/11/09 -

The purifyied Zmpste24 DNA was digested with the restriction enzyme HindIII to create sticky ends using the following method: -

Into an eppendorf tube add:-
- 80 microL PCR product (purified DNA from previous step)
- 10 microL HindIII buffer
- 10 microL HindIII enzyme

Incubate at 37 degrees Celsius for 3 hours.

I then harvested RNA from P.28 and P.29 cells using the same method as previously.

RNA concentration:

P.28 = 465 ng/microL (260/280 = 1.95, 260/230 = 1.26)
P.29 = 475 ng/microL (260/280 = 1.92, 260/230 = 1.28)

17/11/09 -

The digested DNA was then purified again using the phenol cholorform method.

100 microL of water was added to 100 microL of the product then the method was followed exactly as before.
The pellet was resuspended in 50 microL water.

The purified product was then run on a 1.5% agarose gel (made as before) to check if anything had been recovered. But as the gel was setting it had leaked making the gel very thin. After looking under UV light it no band could be seen.

The product was run again along with a 1kb + ladder and pmir report which will be used as the vector. This time a clear band could be seen.

19/11/09 -

All of my cells, except for two flask of P.29, became infected and had to be thrown away. It is thought to be because the medium contained no antibiotics.

Pen Strep antibiotics were added to my medium, then one flask of P.29 cells was passaged to two P.30 flasks. The cells from the other flask were harvested to extract protein as follows:

- Wash cells with 1 x PBS
- Add 1 ml PBS
- Scrape
- Transfer to an eppendorf tube
- Spin at 13,000 rpm for 5 minutes at 4 degrees Celsius
- Remove PBS
- Place pellet on ice
- Resuspend in RIPA buffer (use 3 x the volume of the pellet, in this case we used 100 microL)
(Ensure RIPA buffer has had a protease inhibitor tablet dissolved into it first)
- Leave on ice for 20 minutes
- Centrifuge at 10,000 rpm for 10 minutes at 4 degress Celsius
- Transfer supernatant to a new eppendorf
- Store at -20 degrees Celsius

An agarose gel containing the linearised plasmid was viewed under UV light to allow visualisation of the plasmid, which was then cut out of the gel and put into an eppendorf tube. The plasmid was then extracted using a QIAGEN extraction kit.

20/11/09 -

The DNA concentration of the Zmpste24 PCR product and the pmir report was measured using the nanodrop:

DNA concentration:
Pmir Reporter (which has been cut with HindIII) = 7.6 ng/micro L
Zmpste24 PCR product = 35.6 ng/microL

Four ligations were then set up to run over night.

The amount of insert was kept constant and a final volume of 20 microL was made up using water. The ligations were set up as follows:

1) 1 microL vector + 1 microL insert + 2 microL ligase + 2 microL buffer + 14 microL water
2) 5 microL vector + 1 microL insert + 2 microL ligase + 2 microL buffer + 10 microL water
3) 1 microL vector + 2 microL ligase + 2 microL buffer + 15 microL water
4) 5 microL vector + 2 microL ligase + 2 microL buffer + 11 microL water

Ligations 3 and 4 will act as controls.

The ligations were incubated at 16 degrees Celsius over night in the PCR machine.

Continuing RT and PCR

30/10/09 -

Made an agarose gel consisting of 1.5% (0.75g) agarose with 50ml TBE buffer.

The samples were loaded into the gel with a 1kb ladder. It was run for 1 hour and then the gel was stained with ethidium bromide and was photographed using UV light. Unfortunately the PCR did not work as no DNA was present and only the primers appeared on the gel.

02/11/09 -

RNA was harvested from P.28 cells. This time the TRIzol was put directly into the flask of cells in the hope that this would lyse the cells more efficiently and ensure every cell is collected. This was done in the following way:

- Pour off medium
- Add PBS to wash
- Pour off PBS
**In fume hood**
- Add 1ml TRIzol
- Scrape cells into corner
- Add 500microL to two eppendorfs
- Add 250microL chloroform
-Vortex
Continue extraction process as described previously.

Using the nanodrop the RNA concentration was measured:

RNA concentration - 785.4ng/microL
260/280 - 1.87
260/230 - 0.78

260/280 and 260/230 are both measures of purity. The ideal value for 260/280 should be close to 2 and for 260/230 should be close to 1.

The RNA was then stored at -80 degrees Celsius.

03/11/09 -

cDNA was made from the RNA extracted from the P.28 cells using the same method as previously.

The cDNA was then stored in the freezer.

04/11/09 -

Another PCR reaction was set up in the same manner as before this time with three tubes containing 2 microL cDNA and one tube containing 4 microL cDNA. The final volume was made up to 50 microL using water.

The three tubes were again went through the PCR at three temperatures 50, 55 and 60 degrees Celsius. The tube with 4 microL cDNA was put through the PCR at 55 degrees.

Again I took photos of each flask of cells. Hopefully over time the ageing of the cells will be apparent through these photographs.

05/11/09 -

A 1.5% agarose gel was made and the samples were run for an hour along with a 1kb ladder. The gel was stained with ethidium bromide and photographed under UV light.

Again the PCR did not work, only the primers an primers which had dimerised showed up on the photograph.

This may be because the MRC-5 cells have a low expression of Zmpste24 or that the binding site is right at the end of the 3' UTR and the primers are not binding very well. The next step is to look at the expression of Zmpste24 in these cells as well as a number of other cell lines.

06/11/09 -

Passaged 11 P.28 to 22 P.29 and 2 P.27 to 4 P.28
New medium was added to P.34 and P.35

Harvesting RNA and beginning Reverse Transcriptase and PCR

23/10/09 -

One of the P.26 passage became infected so contents were washed with Trigene to disinfect it and kill everything within, then the contents was disposed of.

After checking cells it was seen that one of the P.34 passages is now senescent. These cells can be seen as they differ from the normal fibroblast cells which are long and thin, where as the senescent cells are flatter, rounder and more relaxed. They are quite noticably different from the dividing cells. The cells were given new medium. P.35 and one P.26 flask were given new medium where as the other 3 of the P.26 flask were passaged to P.27.

Each time the cells are passaged it is a population doubling and the cells are ageing. I will keep passaging the cells to age them and encourage them into senescence while at the same time periodically harvesting RNA.

RNA was harvested from one P.26 passage and one P.35 passage. The same method was done for each passage. This was done as follows: -

- Pour medium away, leaving a little bit in the flask. - using a scraper scrap cells into the corner (you can see the cells moving as they begin to clump together)

- Once you are confident all cells have been scraped off the surface use pipette remaining medium into an eppendorf tube

- Spin tubes to form a pellet

- Remove supernatant

- Resuspend pellet in 1ml of PBS buffer

- Take 2 eppendorf tubes and add 500microL of the buffer mixture

-Centifuge

**Must remember to use green gloves when using TRIzol as it is phenol based**

Then inside a fume hood: -

-Resuspend one of the pellets in 500microL TRIzol and pipette into the other tube, resuspending that pellet

Cells were then frozen and the RNA will be extraced on Monday.

The miR-34a and the miR-34c-5p binding sites within the Zmpste24 binding site have been identified using microRNA.org. It was shown that the binding site is right at the end of the 3'UTR beginning at position 1481. Using the 3'UTR sequence, the binding site has been identified as:

TGAAACATTAAACATTGCCA

Tracey and I discussed the vector we will be using in the cloning. Tracey has previously had success using the Pmir report vector :

We will use only one restriction enzyme (HindIII) to cut the vector. This will allow the gene to be inserted in either orientation, which acts as a control.

The hindIII restriction enzyme recognises and cuts at the following sequence:

This sequence will then have a primer sequence that we will design attached in the 5'-3' direction. At the 5' end we will also attach a short extra sequence, for example GACA, which provide an area for the restriction enzyme to bind. The same process will be done for the other strand aswell.

27/10/09-

The RNA extraction was continued as follows: -

**In fume hood**

- Add 200microL choloform

- Vortex (to mix contents)

- Centrifuge at 13000 rpm for 10 minutes in cold room ( 4 degrees Celsius)

This process will give three phases, the top phase will be RNA, the middle protein and other organic material and the bottom DNA

- Remove top layer, very carefully, and pipette into new eppendorf tube

- Add 500microL isopropenol (which precipitates the RNA into a pellet)

- Leave at room temperature for 5 minutes

- Centrifuge at 13000 rpm for 10 minutes in cold room

-Remove supernatant

- Wash with 70% ethanol, do not resuspend the pellet

- Centrifuge for 10 minutes at 13000 rpm in cold room

- Remove ethanol, use smaller pipette to get rid of dregs

- Leave to air dry

- Resuspend pellet in 20microL in water

The RNA concentration was then measured using the nanodrop. The nanodrop is first blanked with water to callibrate it. Then one microL of each sample is measured.

For a useable sample the minimum amount of RNA wanted is 100ng/microL

Results: -

P.26 = 0.7ng/microL

P.35 = 76ng.microL

P.26 RNA concentration was much to low to use, where as P.35 was just acceptable. The reverse transcription gives 836ng in 11 microL of solution, so it was decided to use this RNA in the PCR reaction.

I also took photos of each flask of cells. This will allow us to record any changes in the appearance of the cells.

29/10/09

First I needed to created the complimentary DNA sequence (cDNA), this was done by using reverse transcriptases, a process which assumes 100% efficieny and so gives 1 microgram of cDNA.

**On ice**

- Add 10 microL RNA to 1 microL oligo dT primers

(These primers put tags which attach to the polyA tails on the ends of the RNA, during the reverse transcriptase process these primers will elongate and prime only the messages, as these are the only RNA which have polyA tails.)

- Incubate at 70 degrees Celsius for 10 minutes

- On ice add:

4 microL 5 X first strand synthesis buffer

2 microL DTT

1 microL dNTPs

2 microL RNase Inhibitor (there is RNase everywhere, on fingers etc. so we need the inhibitor to prevent the RNA being degraded)

- Incubate for 2 minutes at 42 degrees Celsius

- Add 1 microL superscript

- Incubate for one hour at 42 degrees Celsius, then at 70 degrees Celsius for 10 minutes.

New medium was added to P.34 and P.35. The P.35 flask is showing signs of senescence aswell. I will monitor these cells and take pictures to note any differences.

P.26 was passaged to P.27

6 flasks of P.27 were passaged to 12 flasks of P.28

Now we have cDNA a PCR can be carried out to amplify the DNA. This was done as follows:

- In a PCR tube add:

2 microL cDNA

5 microL acutaq buffer

1 microL dNTP

1 microL of each primer (forward and reverse)

1 microL acutaq (a DNA polymerase which decreases the rate of mutation)

The 3 PCRs were carried out over night at 3 different temperatures 50 degrees Celsius, 55 degrees Celsius and 60 degrees Celsius.

Bioinformatics

08/10/09 -
P.24 cells are growing well and are confluent, so were passaged from P.24 to P.25. P.33 cells are growing more slowly, which is usual for human fibroblast cells so new medium was added.

09/10/09 -
P.33 cells passaged to P.34

14/10/09 -
Met with Dylan Edwards (my supervisor) and Tracey Swingler, a postdoctoral research associate in Ian Clarke's research group who will be helping me with my project. Tracey is working on the identification and characterisation of microRNAs involved in chondrogenesis and osteoarthritis, so is experienced in studying microRNAs. I arranged to meet with Tracey on 16/10/09 to discuss my project.

16/10/09 -
The first part of showing a link between zmpste24 and miR-34 is to use bioinformatics to show a theoretical binding site for miR-34 on zmpste24. Tracey demonstrated how to use software such as TargetScan, Pictar, mirbase to find targets for miR-34 or to find all miRNA targets for a protein.
Passaged cells from P.25 to P.26 and passaged one flask of P.34 cells to P.35, but the other flask of P.34 cells had not grown as quickly so new medium was added.

17/10/09-19/10/09 -
Searched through bioinformatics databases. Zmpste24 did not show a binding site for miR-34 in either the well conserved or poorly conserved sites in any of the databases I checked (targetscan, pictar and microRNA.org). Targetscan brought up 114 miRNA targets for Zmpste24 and microRNA.org produced 3,022 theoretical gene targets for miR-34. This may be due to the fact that these databases are constantly being updated and it may have caused zmpste24 to have been lost from the list of gene targets for miR-34, especially if it is a poorly conserved site.

20/10/09 -
Met with Dylan and Tracey to discuss problem of not finding zmpste24 in the databases. When searching the databases lamin A/C came up as a gene target for miR-34, so it was decided to use the lamin A/C protein in the probes instead. Zmpste24 regulates lamin A/C so inhibition of lamin A/C has the same effect on the cells and will produce the same senescence phenotype. Tamas Dalmay, who works with microRNAs investigating their roles in various projects, suggested looking through the sequence of the 3'-UTR of Zmpste24, which can be found using the database Ensembl, to find the miR-34 seed sequence. It is unlikely I will be able to find this sequence as the binding site in Zmpste24 will not be perfectly complimentary, so I could be looking for a number of different combinations of the sequence with any of the bases included.

I looked through the databases again and found on microRNA.org a potential binding site for miR-34 on Zmpste24, starting at bp 1481. I also found the splice variant of lamin A/C which has the longest 3'-UTR using Ensembl. I can use this information and try to find the miR-34 seed sequence with in it.

Tracey and I have decided to start extracting RNA from my cells on 23/10/09, the RNA can be frozen until we are ready to use it. I will also be taking pictures of the cells I have grown which will allow us to visualise the difference between senescent and non-senescent cells.

21/10/09 -
I have had a brief look at the literature to try and establish which form or miR-34 (a, b or c, *,5p or 3p) is the most abundant or shows an effect. So far it seems miR-34a is the most abundant and commonly used form in experiments, but miR-34c is also used. More reading is needed to make a more informed decision.

Inductions and beginning to grow tissue

29/09/2009

Today I had the building induction in the Biomedical Research Centre (BMRC) with Alba Warn. Alba took me through all health and safety procedures and took me around the lab showing me where each research group works, the communal areas, waste disposal, first aid kits and fire exits. Main points to note were:

Chief Technicians - Alba Warn & Jasmine Waters
Emergency Evacuation Procedures - Follow signs to Fire Exits
Alert others by striking 'break glass' boxes to set alarm
Assembly points: Across DMU loading bay for East Wing, and grass between BMRC and Sainsbury Centre for West Wing.
First aid information is on posters at each end of the lab
Labcoats to be worn at all times, along with gloves, goggles, face visor as appropriate (e.g. wear face visor and protective gloves when handling liquid nitrogen).

01/10/2009

Today was my induction to the tissue culture lab, again with Alba Warn. I was shown where all equipment for the Edwards lab and all communal equipment is held. Important points to note:
- Hoods need to be cleaned before and after each use with trigene
- Anything brought into the hood must be disinfected with trigene before it is brought in.
- Lab coats must be worn at all times in the tissue culture lab. This lab coat is kept in the lab.
- Hoods should be booked before hand, and as a matter of courtesy if you finish early, or think you will finish late you should let the next person know.

02/10/2009

I began to grow my cells with Alba. I began by creating my medium by adding L glutamine and foetal calf serum (FCS) to the medium provided. Then added this to cells from passage 23 and 32 which had been stored in liquid nitrogen. These cells were then transferred into small flasks and incubated at 37 degrees celcius.

I also attended the Edwards research group lab meeting and met the other members of the research group.

05/10/2009

Cells were passaged from P23 to P24 and P32 to P33. This was done by first aspirating the medium from the flask, washing with PBS buffer, aspirating again, then washing with TE to remove the cells from the matrix. The cells were transferred to larger flasks along with 10ml of the medium created previously. The cells were incubated again.

07/10/2009

The cells have been growing well but were not yet confluent so today I added fresh medium to feed the cells. I have incubated the cells again and will check on them again tomorrow and decide whether they need to be fed again or to be passaged again.